Review



image acquisition image processing toolboxes release 2015a  (MathWorks Inc)


Bioz Verified Symbol MathWorks Inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    MathWorks Inc image acquisition image processing toolboxes release 2015a
    KEY RESOURCES TABLE
    Image Acquisition Image Processing Toolboxes Release 2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 2720 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/image acquisition image processing toolboxes release 2015a/product/MathWorks Inc
    Average 96 stars, based on 2720 article reviews
    image acquisition image processing toolboxes release 2015a - by Bioz Stars, 2026-04
    96/100 stars

    Images

    1) Product Images from "A Microglia Sublineage Protects from Sex-Linked Anxiety Symptoms and Obsessive Compulsion"

    Article Title: A Microglia Sublineage Protects from Sex-Linked Anxiety Symptoms and Obsessive Compulsion

    Journal: Cell reports

    doi: 10.1016/j.celrep.2019.09.045

    KEY RESOURCES TABLE
    Figure Legend Snippet: KEY RESOURCES TABLE

    Techniques Used: Recombinant, Enzyme-linked Immunosorbent Assay, Software



    Similar Products

    image acquisition image processing toolboxes release 2015a  (MathWorks Inc)
    96
    MathWorks Inc image acquisition image processing toolboxes release 2015a
    KEY RESOURCES TABLE
    Image Acquisition Image Processing Toolboxes Release 2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/image acquisition image processing toolboxes release 2015a/product/MathWorks Inc
    Average 96 stars, based on 1 article reviews
    image acquisition image processing toolboxes release 2015a - by Bioz Stars, 2026-04
    96/100 stars
    		  Buy from Supplier
    and image acquisition/image processing toolboxes release 2015a  (MathWorks Inc)
    90
    MathWorks Inc and image acquisition/image processing toolboxes release 2015a
    KEY RESOURCES TABLE
    And Image Acquisition/Image Processing Toolboxes Release 2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/and image acquisition/image processing toolboxes release 2015a/product/MathWorks Inc
    Average 90 stars, based on 1 article reviews
    and image acquisition/image processing toolboxes release 2015a - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    KEY RESOURCES TABLE

    Journal: Cell reports

    Article Title: A Microglia Sublineage Protects from Sex-Linked Anxiety Symptoms and Obsessive Compulsion

    doi: 10.1016/j.celrep.2019.09.045

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-RFP Rockland Cat#600-401-379; RRID:AB_2209751 anti-lba1 Wako Cat#019–19741; RRID:AB_839504 Alexa Fluor 555 Invitrogen Cat#A31572; RRID:AB_162543 anti CD11b-APC BioLegend Cat#101212; RRID: AB_312795 anti CD45-FITC BioLegend Cat#103108; RRID: AB_312973 Chemicals, Peptides, and Recombinant Proteins Urocortin II Millipore-Sigma Cat# U9507 Trilostane Millipore-Sigma Cat#SML0141 Estrogen Millipore-Sigma Cat#PHR1353 Progesterone Millipore-Sigma Cat#P3972 Critical Commercial Assays Cortisol ELISA Kit Arbor Assays Cat#K003 Estradiol ELISA Kit Arbor Assays Cat#K030 Progesterone ELISA Kit Arbor Assays Cat#K025 Creatinine Urinary Detection Kit Arbor Assays Cat#K002 Deposited Data raw and analyzed data This paper N/A Experimental Models: Organisms/Strains Hoxb8 ko Mario Capecchi RRID 4818890 Hoxb8 IRES-Cre Mario Capecchi RRID 4837097 Hoxb8 mut-IRES-Cre This paper N/A Csf1r flox The Jackson Laboratory Stock# 021212; RRID 3653677 Rosa26 lsl-tdTomato The Jackson Laboratory Stock# 007914; RRID 4436847 Oligonucleotides Hoxb8 mut-IRES-Cre genotyping primer: gccagacctacagtcgctacca (forward) This paper N/A Hoxb8 mut-IRES-Cre genotyping primer: cttcttgtcacccttctgcgcatcg (reverse) This paper N/A Software and Algorithms MATLAB and Image Acquisition/Image Processing Toolboxes Release 2015a The MathWorks, Inc. https://www.mathworks.com/products/get-matlab.html?s_tid=gn_getml Leica Application Suite X Leica Microsystems https://www.leica-microsystems.com/products/microscope-software/p/leica-las-x-ls/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FlowJo FlowJo, LLC https://www.flowjo.com/solutions/flowjo/downloads GraphPad Prism version 8.0.0 GraphPad Software https://www.graphpad.com Open in a separate window KEY RESOURCES TABLE A microglia sublineage derived from Hoxb8-expressing precursors serves unique functions Dysfunction of Hoxb8-lineage microglia causes anxiety symptoms and obsessive compulsion Female sex hormones worsen the pathology caused by Hoxb8-lineage microglia dysfunction

    Techniques: Recombinant, Enzyme-linked Immunosorbent Assay, Software